QiagenGeneGlobe
 Custom Products Analyze Knowledge Services
icon_0009_cart-s Cart
null
null
Schematic outline of the miRCURY LNA miRNA PCR System.
Accurate quantitation from down to 1 pg total RNA starting material.
miRCURY LNA miRNA PCR System at a glance.
Serial dilution of hsa-miR-181a.
Expression levels of reference genes in different human tissues.
LNA-enhanced primers result in greatly increased sensitivity compared to DNA primers.
Detection of differential expression of miRNAs in LCM specimens from tissue FFPE sections.
Single nucleotide discrimination.
Specific and sensitive amplification of miRNA.
Differences in miRNA expression between serum samples.
Specificity test alongside competitor probe-based miRNA qPCR system.
GeneGlobe ID: YP02109195 | Cat. No.: 339306 | miRCURY LNA miRNA PCR Assays

hsa-miR-6757-5p miRCURY LNA miRNA PCR Assay

Product Specification

Pre-designed assay for dPCR and qPCR. Wet-lab verified for qPCR.
Targets similar miRNAs across multiple species.
Name​
hsa-miR-6757-5p (YP02109195)
Species​
Human (Homo sapiens)
Wet-lab verified​
qPCR wet-lab verified
Targets (mature miR)
miRBase ID​
hsa-miR-6757-5p
miRBase Accession​
MIMAT0027414
Mature miRNA sequence​
UAGGGAUGGGAGGCCAGGAUGA
Additional info (miRNA stem loop(s))
miRBase ID​
hsa-mir-6757
miRBase Accession​
MI0022602
Description​
Homo sapiens miR-6757 stem-loop
miRNA sequence (pre-miR)​
GGGCUUAGGGAUGGGAGGCCAGGAUGAAGAUUAAUCCCUAAUCCCCAACACUGGCCUUGCUAUCCCCAG
miRNAs amplified by this miRCURY LNA PCR Assay​
hsa-miR-6757-5p

Resources

Introducing the hsa-miR-6757-5p miRCURY LNA miRNA PCR Assay, a cutting-edge addition to our miRCURY LNA miRNA PCR Assays lineup, specifically designed for RNA expression applications. This premium product offers unparalleled performance for researchers working with Human models. Leveraging advanced technology, the hsa-miR-6757-5p miRCURY LNA miRNA PCR Assay facilitates accurate and reliable results, making it an indispensable tool for your scientific investigations. Whether you're conducting RNA expression, or any other sophisticated analyses, this product from our miRCURY LNA miRNA PCR Assays collection ensures optimal efficiency and reproducibility for Human studies. Embrace the future of research with hsa-miR-6757-5p miRCURY LNA miRNA PCR Assay and elevate your work to new heights.
Country and Language
Contact us
Sample to Insight
© QIAGEN 2013–25. All rights reserved
Privacy PolicyTrademarks and DisclaimersImpressum